WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00126453 Gene Name  Cjp-unc-97
Sequence Name  ? CJA07249 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: LIM domain; LIM and senescent cell antigen-like-containing domain protein 1-like; and Zinc finger, LIM-type. Is an ortholog of C. elegans unc-97. In C. elegans, unc-97 is involved in several processes, including muscle cell cellular homeostasis; positive regulation of sarcomere organization; and sensory perception of mechanical stimulus. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA07249.1 CJA07249.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA07249 CJA07249   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA26541, ACAAAGTTCTATGAATTCGATATGAAACCGACATGTAGACGATGCTACGATAGGTTCCCA, WBGene00182113   Expr1083282 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-unc-97, AAGCTCTTCAGAAGACGTGGTGTGTCAAGTGTTTCTCGTGCAGTTTCTGTGACAAGAAAC, WBGene00126453   Expr1076703 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region