WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00121040 Gene Name  Cjp-csn-1
Sequence Name  ? CJA01836 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: 26S proteasome subunit RPN7; Proteasome component (PCI) domain; 26S proteasome regulatory subunit Rpn7/COP9 signalosome complex subunit 1; Winged helix DNA-binding domain superfamily; PCI domain; and COP9 signalosome complex subunit 1. Is an ortholog of C. elegans csn-1. In C. elegans, csn-1 is involved in cell cycle switching and regulation of oogenesis. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA01836.1 CJA01836.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA01836 CJA01836   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-csn-1, AAAATCGACCAGAGTGCCGGTCTACTACGAATGATTGATAATAAAGACGAGGAGACCACG, WBGene00121040   Expr1092096 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region