WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00131098 Gene Name  Cjp-acs-19.1
Sequence Name  ? CJA11894 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: AMP-dependent synthetase/ligase; AMP-binding enzyme; ANL, N-terminal domain; Acetyl-coenzyme A synthetase, N-terminal domain; and Acetyl-coenzyme A synthetase N-terminus. Is an ortholog of C. elegans acs-19. In C. elegans, acs-19 is involved in positive regulation of proteasomal ubiquitin-dependent protein catabolic process and regulation of response to oxidative stress. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA11894.1 CJA11894.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA11894 CJA11894   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA21495, AAGAGAACGTTCAAGTTTCCTCTGTCATTATGGTGGAGCATTTGAAGCGGGTGACTAAGC, WBGene00177067   Expr1091892 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-acs-19, GAAAACCAAAGGGAATTCAGCACACGACCGCCGGATACATGACGTATGCCTATGCAACCA, WBGene00131098   Expr1080037 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region