WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00138139 Gene Name  Cjp-clk-2
Sequence Name  ? CJA18935 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: TEL2, C-terminal domain superfamily; Telomere length regulation protein; and Telomere length regulation protein, conserved domain. Is an ortholog of C. elegans clk-2. In C. elegans, clk-2 is involved in several processes, including DNA damage checkpoint signaling; determination of adult lifespan; and response to radiation. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA18935.1 CJA18935.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA18935 CJA18935   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-clk-2, GCACCGCTACTCGGAGAATCCAAAAGTTCGTGGCGCCTGTCTTGCCGCACATCTCAACGT, WBGene00138139   Expr1088253 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region