WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00123624 Gene Name  Cjp-rpn-10.1
Sequence Name  ? CJA04420 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Proteasome subunit Rpn10; von Willebrand factor type A domain; Ubiquitin interacting motif; von Willebrand factor A-like domain superfamily; Ubiquitin interaction motif; and von Willebrand factor, type A. Is an ortholog of C. elegans rpn-10. In C. elegans, rpn-10 is involved in spermatogenesis and ubiquitin-dependent protein catabolic process. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA04420.1 CJA04420.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA04420 CJA04420   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-rpn-10, GAACTGCTCCAACAGATTGTCAACGAGCTGCCAGAGCACGGAAATGAAGAGGAGGAGGAA, WBGene00123624   Expr1077725 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region