WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00180283 Gene Name  Cjp-sfrp-1
Sequence Name  ? CJA24711 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Frizzled/secreted frizzled-related protein; Fz domain; Frizzled domain; and Frizzled cysteine-rich domain superfamily. Is an ortholog of C. elegans sfrp-1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA24711b.1 CJA24711b.1   [unknown]
Transcript:CJA24711c.1 CJA24711c.1   [unknown]
Transcript:CJA24711a.1 CJA24711a.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA24711c CJA24711c   [unknown]
CDS:CJA24711b CJA24711b   [unknown]
CDS:CJA24711a CJA24711a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA24711, TGGGTCGAGAAATTCGCGAGTCCGCTTCAAAAAGACCACATTATTACGAAATGCGACGTC, WBGene00180283   Expr1083649 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region