Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG05497a.1 | CBG05497a.1 | [unknown] | |
| Transcript:CBG05497b.1 | CBG05497b.1 | [unknown] |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:CBG05497a | CBG05497a | [unknown] | |
| CDS:CBG05497b | CBG05497b | [unknown] |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated | |
| Virus infection: Santeuil infected at L3 larva stage for 12 hours. | Transcripts that showed signicantly increased expression after Santeuil virus infection to C. briggsae strain JU1264. | edgeR, FDR < 0.05. | WBPaper00051137:Santeuil-virus_upregulated_JU1264 |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG05497, ACGTTGCCCGTTTTGAGCTATCAAGGAGCATCAGAAACTTCGAAATTTCCAGTGGTTTAT, WBGene00027937 | Expr1070096 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
