WormBase Gene ID
|
WBGene00131011 | Gene Name | Cjp-let-767 |
| Sequence Name
|
CJA11807 | Organism | Caenorhabditis japonica |
| Automated Description | Is predicted to encode a protein with the following domains: RPN13, DEUBAD domain superfamily; NAD(P)-binding domain superfamily; Short-chain dehydrogenase/reductase SDR; and short chain dehydrogenase. Is an ortholog of C. elegans let-767. In C. elegans, let-767 is involved in several processes, including establishment or maintenance of epithelial cell apical/basal polarity; long-chain fatty acid biosynthetic process; and steroid metabolic process. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA11807.1 | CJA11807.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CJA20453, GGTCAAGGATTACGCCGTGCACATGTTGAACAGCAAAAAATCGCTGTTGGAGACGGGATC, WBGene00176025 | Expr1071671 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
