WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00060412 Gene Name  Cre-rps-10
Sequence Name  ? CRE03862 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Winged helix-like DNA-binding domain superfamily; Plectin/S10, N-terminal; 40S Ribosomal protein S10; and Plectin/S10 domain. Is an ortholog of C. elegans rps-10. In C. elegans, rps-10 is involved in determination of adult lifespan. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE03862a.1 CRE03862a.1   [unknown]
Transcript:CRE03862b.1 CRE03862b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE03862a CRE03862a   [unknown]
CDS:CRE03862b CRE03862b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro. N.A WBPaper00054996:activated_sperm_CRE
  Proteins expressed in membranous oraganelle fraction after C. remanei spermatids were activated in vitro. N.A WBPaper00054996:membranous_oraganelle_CRE

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-rps-10, CTGTCGCCAAGAAAGACTTCAATGCCAAGACTCACCCAAATATCGATGGAGTTTCCAACC, WBGene00060412   Expr1112132 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region