WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00270724 Gene Name  CBG30670
Sequence Name  ? CBG30670 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: C-type lectin fold; CUB domain; C-type lectin-like; Spermadhesin, CUB domain superfamily; C-type lectin-like/link domain superfamily; and Lectin C-type domain. Is an ortholog of C. elegans clec-227 and clec-56. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG30670.1 CBG30670.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG30670 CBG30670   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG04602, CTTCGAGAGTTCTAATAATTCCATCTCATTCCGATTCCGTACGAACAGCGTCATTACAAA, WBGene00027241   Expr1055584 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region