WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00059872 Gene Name  Cre-mus-101
Sequence Name  ? CRE29614 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: BRCT domain superfamily; BRCT domain, a BRCA1 C-terminus domain; BRCA1 C Terminus (BRCT) domain; twin BRCT domain; BRCT domain; and Regulator of Ty1 transposition protein 107 BRCT domain. Is an ortholog of C. elegans mus-101. In C. elegans, mus-101 is involved in several processes, including DNA damage response; DNA-templated DNA replication; and germ cell proliferation. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE29614.1 CRE29614.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE29614 CRE29614   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-mus-101, ACATGCCGCTCTACATCATCGAAATAATATACGAGTATCTCGTCGACAAGGATAACTTGG, WBGene00059872   Expr1111278 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region