WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00059989 Gene Name  Cre-fog-3
Sequence Name  ? CRE29557 Organism  Caenorhabditis remanei
Automated Description  Expressed in male. Is an ortholog of C. elegans fog-3. In C. elegans, fog-3 is involved in cell fate specification; developmental process involved in reproduction; and positive regulation of oocyte development. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE29557.1 CRE29557.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE29557 CRE29557   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-fog-3, GAAAAGTCTTCTTCCGTGGTTCTTTGGACGGGATCGAGGTCCCAATATGGAATGGAGAAG, WBGene00059989   Expr1110759 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr11506 In C remanei both larval and adult males produce high levels of fog-3, but neither larval nor adult females produce detectable levels of this message.  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region