WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00059348 Gene Name  Cre-ric-3.1
Sequence Name  ? CRE11025 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Resistance to inhibitors of cholinesterase protein 3, N-terminal; Resistance to inhibitors of cholinesterase homologue 3; and Resistance to inhibitors of cholinesterase protein 3. Is an ortholog of C. elegans ric-3. In C. elegans, ric-3 is involved in several processes, including cholinergic synaptic transmission; positive regulation of cholinergic synaptic transmission; and protein localization to cell surface. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE11025.1 CRE11025.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE11025 CRE11025   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-ric-3, TGATGCTGAAGAAGAAGAAGGAATTGATATTGATTCGGAGATTCAAGAGCAAGCGGAACG, WBGene00059348   Expr1101446 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region