WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00181337 Gene Name  CJA25765
Sequence Name  ? CJA25765 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: snRNA-activating protein complex (SNAPc), subunit 3 and snRNA-activating protein complex, subunit 3. Is an ortholog of C. elegans snpc-3.1; snpc-3.2; and snpc-3.3. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA25765a.1 CJA25765a.1   [unknown]
Transcript:CJA25765b.1 CJA25765b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA25765b CJA25765b   [unknown]
CDS:CJA25765a CJA25765a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA00256, AAGAGGGATTTGAGGCCGAAAAGGGTTACGGTGAAGAGGGAAAGCAGCGCGAGTTTTGAT, WBGene00119461   Expr1074048 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA25765, GGGTATATGTGCACTTTGTGTTACGAGGAAATGTGTTTCGATGTGAATGGCGATAAAGTT, WBGene00181337   Expr1089565 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region