WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00057448 Gene Name  Cre-smc-5
Sequence Name  ? CRE11734 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Structural maintenance of chromosomes protein 5; RecF/RecN/SMC, N-terminal; P-loop containing nucleoside triphosphate hydrolase; and RecF/RecN/SMC N terminal domain. Is an ortholog of C. elegans smc-5. In C. elegans, smc-5 is involved in meiotic DNA double-strand break processing involved in reciprocal meiotic recombination. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE11734.1 CRE11734.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE11734 CRE11734   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE11734, TCGATATCATGGTTGGATTGTGGAACGGAACAAGTGGATCACTCACCAAAACGCAATACT, WBGene00057448   Expr1112695 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region