WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00057947 Gene Name  Cre-memo-1
Sequence Name  ? CRE18617 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Memo-like protein and MEMO1 family. Is an ortholog of C. elegans memo-1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE18617a.1 CRE18617a.1   [unknown]
Transcript:CRE18617b.1 CRE18617b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE18617a CRE18617a   [unknown]
CDS:CRE18617b CRE18617b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE18616, GAATAAGTCAACCTGTGTGACAGTCTTCTCTTTTCAAGCCTTTATTCTACGGGTATATTC, WBGene00082415   Expr1106413 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cre-tag-253, GGTCGGAATCCCATATTGATTATGCTGCAGGCAGCGGAACATTTTCGATTGAGTAACAAC, WBGene00057947   Expr1096989 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region