WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00058169 Gene Name  Cre-syg-1
Sequence Name  ? CRE07370 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Immunoglobulin domain; Immunoglobulin I-set; Immunoglobulin subtype 2; Immunoglobulin subtype; Immunoglobulin-like fold; Immunoglobulin-like domain superfamily; Immunoglobulin I-set domain; CD80-like C2-set immunoglobulin domain; Immunoglobulin-like domain; and CD80-like, immunoglobulin C2-set. Is an ortholog of C. elegans syg-1. In C. elegans, syg-1 is involved in several processes, including actin filament bundle assembly; cell-cell adhesion; and nervous system development. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE07370.1 CRE07370.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE07370 CRE07370   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-syg-1, CGGTGAAACTTGCTCTCCAATATGCACCCCAAATCAATTTGACTATTGCATCGAAGGTTC, WBGene00058169   Expr1109051 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region