WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00058442 Gene Name  Cre-syd-2
Sequence Name  ? CRE07406 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Liprin-alpha; LAR-interacting protein, Liprin; Sterile alpha motif domain; SAM domain (Sterile alpha motif); and Sterile alpha motif/pointed domain superfamily. Is an ortholog of C. elegans syd-2. In C. elegans, syd-2 is involved in several processes, including anterograde synaptic vesicle transport; egg-laying behavior; and positive regulation of anterograde synaptic vesicle transport. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE07406.1 CRE07406.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE07406 CRE07406   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-syd-2, GAGACTTTTGATTCTTCAGCATTTGCCTACGCACTGCAAATGGGATCTCAAGATATAGCC, WBGene00058442   Expr1101823 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region