WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00055941 Gene Name  Cre-dnj-27
Sequence Name  ? CRE28640 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Thioredoxin; Chaperone J-domain superfamily; DnaJ domain; Thioredoxin-like superfamily; and Thioredoxin domain. Is an ortholog of C. elegans dnj-27. In C. elegans, dnj-27 is involved in IRE1-mediated unfolded protein response. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE28640.1 CRE28640.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE28640 CRE28640   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-dnj-27, GTCTCGACAAGATGTTATGGGTTACGGTATTGGAACACAGCACAAGGAGCAGTTCATTCA, WBGene00055941   Expr1109853 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region