WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00055940 Gene Name  Cre-ced-1
Sequence Name  ? CRE28349 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Furin-like repeat; EGF-like domain; Laminin-type EGF domain; and Laminin EGF domain. Is an ortholog of C. elegans ced-1. In C. elegans, ced-1 is involved in several processes, including cytoskeleton organization; phagocytosis; and response to stress. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE28349.1 CRE28349.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE28349 CRE28349   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-ced-1, AATGTTCTAAAGAATGTCCCAAAGACGGATGCGGTGATGGATACGAATGTGATGCAGCTA, WBGene00055940   Expr1115399 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region