WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00055910 Gene Name  Cre-tra-1.2
Sequence Name  ? CRE04883 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Zinc finger, C2H2 type; Zinc finger C2H2-type; and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans tra-1. In C. elegans, tra-1 is involved in developmental process involved in reproduction; negative regulation of transcription by RNA polymerase II; and positive regulation of neuron apoptotic process. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE04883.1 CRE04883.1   [unknown]
Transcript:CRE04883.2 CRE04883.2   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE04883 CRE04883   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-tra-1, CTTCACTCCGAAAGCACATCAAAGCGGTTCATGGTGATGAGGAGTATGAGAAAGCGAAAA, WBGene00055910   Expr1102360 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CRE04884, GACCCCGAAACTGTTGTTGATGCTCAACGTCGTGGCAGCTTCTCAAAGAAGAAAAATGGA, WBGene00055911   Expr1115789 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region