WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00053160 Gene Name  CRE05785
Sequence Name  ? CRE05785 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: MSP (Major sperm protein) domain; Major sperm protein (MSP) domain; Immunoglobulin-like fold; and PapD-like superfamily. Is an ortholog of C. elegans ZK1248.17. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE05785.1 CRE05785.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE05785 CRE05785   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

3 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro. N.A WBPaper00054996:activated_sperm_CRE
  Proteins expressed in membranous oraganelle fraction after C. remanei spermatids were activated in vitro. N.A WBPaper00054996:membranous_oraganelle_CRE
  Proteins expressed in unactivated C. remanei spermatids. N.A WBPaper00054996:unactivated_spermatid_CRE

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE16231, CAAGGTGATCAACTCTTCGGCTCGTCGTATTGGGTATGGAATCAAGACAACCAACATGAA, WBGene00065352   Expr1110850 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CRE05785, TCCGTCGTGAATGTTTCCAAGAAAATGGAATGGTCCGTCGTAAAAACTTGCCGATCGAAT, WBGene00053160   Expr1106746 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region