WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00053657 Gene Name  Cre-zyx-1
Sequence Name  ? CRE01699 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: LIM domain and Zinc finger, LIM-type. Is an ortholog of C. elegans zyx-1. In C. elegans, zyx-1 is involved in maintenance of synapse structure. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE01699.1 CRE01699.1   [unknown]
Transcript:CRE01699.2 CRE01699.2   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE01699 CRE01699   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-zyx-1, GAGTGTACCATGTCAACTGTTTTGTGTGTTATTCATGCAAAAAGTCCCTCGATGGAATTC, WBGene00053657   Expr1096256 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region