WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00053379 Gene Name  Cre-clec-60
Sequence Name  ? CRE01842 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: C-type lectin fold; C-type lectin-like; von Willebrand factor type A domain; von Willebrand factor A-like domain superfamily; C-type lectin-like/link domain superfamily; and von Willebrand factor, type A. Is an ortholog of C. elegans clec-60. In C. elegans, clec-60 is involved in defense response to Gram-positive bacterium. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE01842.1 CRE01842.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE01842 CRE01842   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-clec-60, CATTCAGTTATCACATTGGACTCAACTATGTCAAAGGAGTTTGGGTATGGGATCAACCAG, WBGene00053379   Expr1106292 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region