WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00054217 Gene Name  Cre-malt-1
Sequence Name  ? CRE26198 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Caspase-like domain superfamily; Immunoglobulin domain; Death-like domain superfamily; Immunoglobulin-like fold; Immunoglobulin-like domain superfamily; MALT1 immunoglobulin-like domain; Caspase domain; and MALT1 Ig-like domain. Is an ortholog of C. elegans malt-1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE26198.1 CRE26198.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE26198 CRE26198   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE26198, ATATTCGATGGACACACTGCCTCATTCGATAATCATACAATTCACTGGAGACTTATGCAT, WBGene00054217   Expr1094763 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region