WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00054956 Gene Name  Cre-ekl-6
Sequence Name  ? CRE25513 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: TANGO6/Rtp1; Armadillo-like helical; Required for nuclear transport of RNA pol II C-terminus 1; RNA polymerase II assembly factor Rtp1, C-terminal; and Armadillo-type fold. Is an ortholog of C. elegans ekl-6. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE25513.1 CRE25513.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE25513 CRE25513   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-ekl-6, CTTCATGCTCAGTTGTGCGTTGAAGAGATCGCTGCAGCTCTCCGTCAGAATCAAGAAGAC, WBGene00054956   Expr1098372 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region