WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00054941 Gene Name  Cre-ham-3
Sequence Name  ? CRE25507 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: SWIB domain; SWIB/MDM2 domain; and SWIB/MDM2 domain superfamily. Is an ortholog of C. elegans ham-3. In C. elegans, ham-3 is involved in determination of adult lifespan; negative regulation of transcription by RNA polymerase II; and positive regulation of transcription by RNA polymerase II. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE25507.1 CRE25507.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE25507 CRE25507   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-tag-246, AAGAAGTGGGTCATCAGCCAAAATGCTGACCTGAAGACGTTGACTGAATCAAGCGGAGAC, WBGene00054941   Expr1102950 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region