WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00134386 Gene Name  Cjp-unc-93
Sequence Name  ? CJA15182 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domain: MFS transporter superfamily. Is an ortholog of C. elegans unc-93. In C. elegans, unc-93 is involved in regulation of muscle contraction and regulation of potassium ion transport. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA15182c.1 CJA15182c.1   [unknown]
Transcript:CJA15182b.1 CJA15182b.1   [unknown]
Transcript:CJA15182a.1 CJA15182a.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA15182c CJA15182c   [unknown]
CDS:CJA15182b CJA15182b   [unknown]
CDS:CJA15182a CJA15182a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-unc-93, ATCAGTGGTATGATTGTGAGCATGTTTCTCAACGCTCTAATGAAAGATGCTCGTAATCGA, WBGene00134386   Expr1071960 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region