WormBase Gene ID
|
WBGene00054659 | Gene Name | Cre-ten-1 |
| Sequence Name
|
CRE25359 | Organism | Caenorhabditis remanei |
| Automated Description | Is predicted to encode a protein with the following domains: Six-bladed beta-propeller, TolB-like; EGF-like domain; GHH signature containing HNH/Endo VII superfamily nuclease toxin; EGF-like domain, extracellular; Quinoprotein amine dehydrogenase, beta chain-like; and Tox-GHH domain. Is an ortholog of C. elegans ten-1. In C. elegans, ten-1 is involved in several processes, including body morphogenesis; inductive cell migration; and system development. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CRE25359.1 | CRE25359.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cre-ten-1, GAGTTGAGGAACGGAAAGTCCAAGATTGTTGTGCACTTCGCCGATAATAAGGTTTGTGTT, WBGene00054659 | Expr1106893 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
