WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00138648 Gene Name  CJA19444
Sequence Name  ? CJA19444 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Helicase, C-terminal; P-loop containing nucleoside triphosphate hydrolase; and Helicase conserved C-terminal domain. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA19444b.1 CJA19444b.1   [unknown]
Transcript:CJA19444a.1 CJA19444a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA19444a CJA19444a   [unknown]
CDS:CJA19444b CJA19444b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA19444, TTTGGCAGTGGGTACAAGTATGATGAGGGTGAGGCGGAAGCGGATGCGAACAAGAAGAAA, WBGene00138648   Expr1085598 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA28647, GACAACTCGTCGTGTGAAAAAAAGAGGCCAGTCCGATAAACCGTCAACTTCGGGAGGAGC, WBGene00184221   Expr1073216 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region