WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00213082 Gene Name  CJA37235
Sequence Name  ? CJA37235 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Target SNARE coiled-coil homology domain; HAD superfamily; Haloacid dehalogenase-like hydrolase; HAD-hyrolase-like; HAD-superfamily hydrolase, subfamily IIA; and HAD-like superfamily. Is an ortholog of C. elegans C45E5.1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA37235a.1 CJA37235a.1   [unknown]
Transcript:CJA37235b.1 CJA37235b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA37235b CJA37235b   [unknown]
CDS:CJA37235a CJA37235a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA18997, GAAGAGAACTGTGATGTTCGGAGATCGTCTCGACACGGATGTCATGTTTGGAAACGCCAA, WBGene00138201   Expr1087792 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region