WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00051375 Gene Name  Cre-lam-2
Sequence Name  ? CRE00094 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: EGF-like domain; Laminin-type EGF domain; Laminin N-terminal (Domain VI); Laminin B (Domain IV); Galactose-binding-like domain superfamily; Laminin, N-terminal; Laminin IV; and Laminin EGF domain. Is an ortholog of C. elegans lam-2. In C. elegans, lam-2 is involved in positive regulation of locomotion. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE00094.1 CRE00094.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE00094 CRE00094   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-lam-2, CGTTGAATCTGTGTCAACTGCTGATAAGACTTTAAAGGATGCCGAAGCCGCACTTGCAAC, WBGene00051375   Expr1105880 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region