WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00052625 Gene Name  CRE27471
Sequence Name  ? CRE27471 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Hsp20/alpha crystallin family; Alpha crystallin/Hsp20 domain; Alpha crystallin/Small heat shock protein, animal type; and HSP20-like chaperone. Is an ortholog of C. elegans hsp-16.41 and hsp-16.48. In C. elegans, hsp-16.41 is involved in defense response to Gram-negative bacterium and response to heat. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE27471.1 CRE27471.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE27471 CRE27471   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE27471, CTCCAGATTGAGGCACCAAAGACTGCAAACACATCTCGTTCTATTCCAATCAATTTCGTG, WBGene00052625   Expr1105489 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region