WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00052175 Gene Name  Cre-dre-1
Sequence Name  ? CRE31141 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Right handed beta helix region; Pectin lyase fold; F-box-like domain superfamily; Right handed beta helix domain; Parallel beta-helix repeat; Parallel beta-helix repeat-2; Pectin lyase fold/virulence factor; F-box-like; F-box only protein 11; F-box domain; and Carbohydrate-binding/sugar hydrolysis domain. Is an ortholog of C. elegans dre-1. In C. elegans, dre-1 is involved in several processes, including mesodermal cell migration; nematode larval development; and positive regulation of apoptotic process involved in development. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE31141.1 CRE31141.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE31141 CRE31141   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-dre-1, AGGTCTTCTCGAGGATAATGAAATCTTCCGAAATGCCCAAGCAGGTGTTCTCATTTCAAC, WBGene00052175   Expr1108445 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region