WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00052277 Gene Name  Cre-tofu-2
Sequence Name  ? CRE27298 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Schlafen family; Schlafen, AlbA_2 domain; Putative DNA-binding domain; and Schlafen, AlbA_2 domain superfamily. Is an ortholog of C. elegans tofu-2. In C. elegans, tofu-2 is involved in primary piRNA processing. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE27298.1 CRE27298.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE27298 CRE27298   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE27298, AACAAATGCGTTTACCTAGACGATCTCCGCCGCATGATGAATGAGAGAAATCGAGTTTTT, WBGene00052277   Expr1112996 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region