WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00126383 Gene Name  CJA07179
Sequence Name  ? CJA07179 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Tetratricopeptide repeat protein 5, OB fold domain; Tetratricopeptide-like helical domain superfamily; Tetratricopeptide repeat protein 5 OB fold domain; TTC5, OB fold domain superfamily; and Tetratricopeptide repeat. Is an ortholog of C. elegans Y37E3.1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA07179.1 CJA07179.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA07179 CJA07179   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA07179, GATAAGGTGGATTCGGGTGGCCACGCCCACTCAGATTAAGAAAAATGGAGCAGCGTTGCC, WBGene00126383   Expr1091610 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region