WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00026028 Gene Name  CBG03096
Sequence Name  ? CBG03096 Organism  Caenorhabditis briggsae
Automated Description  Is affected by Cbr-spr-4 based on RNA-seq studies. Is predicted to encode a protein with the following domains: C-type lectin fold; C-type lectin-like; von Willebrand factor type A domain; von Willebrand factor A-like domain superfamily; C-type lectin-like/link domain superfamily; and von Willebrand factor, type A. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

5 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG03096a.2 CBG03096a.2   [unknown]
Transcript:CBG03096a.1 CBG03096a.1   [unknown]
Transcript:CBG03096b.3 CBG03096b.3   [unknown]
Transcript:CBG03096b.2 CBG03096b.2   [unknown]
Transcript:CBG03096b.1 CBG03096b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG03096b CBG03096b   [unknown]
CDS:CBG03096a CBG03096a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG03096, AATGCTATGGGTGAAGCACACTATTATGTTTGTGAAGTCGCTTCTTGTGATACGGATAAT, WBGene00026028   Expr1061039 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region