WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00136945 Gene Name  Cjp-unc-52
Sequence Name  ? CJA17741 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Low-density lipoprotein receptor domain class A; Laminin-type EGF domain; Immunoglobulin domain; Laminin B (Domain IV); Immunoglobulin I-set; Immunoglobulin subtype 2; Low-density lipoprotein (LDL) receptor class A repeat; Laminin IV; Immunoglobulin subtype; Immunoglobulin-like fold; Immunoglobulin I-set domain; Immunoglobulin-like domain superfamily; LDL receptor-like superfamily; Laminin EGF domain; and Immunoglobulin-like domain. Is an ortholog of C. elegans unc-52. In C. elegans, unc-52 is involved in several processes, including hemidesmosome assembly; muscle cell cellular homeostasis; and muscle structure development. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA17741a.1 CJA17741a.1   [unknown]
Transcript:CJA17741b.1 CJA17741b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA17741b CJA17741b   [unknown]
CDS:CJA17741a CJA17741a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-unc-52, GAATGCATTGCGAGAGATGCAAGAAGGGTTATTATGGAGATGCCACCAAGGGATCGCCAT, WBGene00123054   Expr1070428 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA17741, CAAAGAGGACAACGCCGGTGTCTACAGATGTGTGGCGAAGACAAAAGCAGGACCACTACA, WBGene00136945   Expr1072054 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region