WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00037749 Gene Name  CBG18302
Sequence Name  ? CBG18302 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Somatomedin-B and thrombospondin type-1 domain-containing protein; Thrombospondin type-1 (TSP1) repeat superfamily; Somatomedin B domain; Thrombospondin type-1 (TSP1) repeat; and Somatomedin B-like domain superfamily. Is an ortholog of C. elegans sbsp-1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG18302b.1 CBG18302b.1   [unknown]
Transcript:CBG18302a.1 CBG18302a.1   [unknown]
Transcript:CBG18302d.1 CBG18302d.1   [unknown]
Transcript:CBG18302c.1 CBG18302c.1   [unknown]
 

Other

4 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG18302d CBG18302d   [unknown]
CDS:CBG18302b CBG18302b   [unknown]
CDS:CBG18302c CBG18302c   [unknown]
CDS:CBG18302a CBG18302a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

3 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_upregulated
  Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day3_vs_Day1_downregulated
  Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day6_vs_Day1_downregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG18302, GAATCAATCGAACCGACAATTGCCAGTGCCAAGTACAGTATCCCCAGAATCACCCATTTC, WBGene00037749   Expr1057200 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region