WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00060848 Gene Name  Cre-lev-11
Sequence Name  ? CRE14242 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Tropomyosin like and Tropomyosin. Is an ortholog of C. elegans lev-11. In C. elegans, lev-11 is involved in several processes, including actin filament organization; regulation of actin polymerization or depolymerization; and spicule insertion. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE14242.1 CRE14242.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE14242 CRE14242   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-lev-11, GAATTGGTGCACGAGAAGGAACGTTACAAGACCATCTCCGAGGAGCTCGACTCCACCTTC, WBGene00060848   Expr1100938 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region