WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00088661 Gene Name  CBG27247
Sequence Name  ? CBG27247 Organism  Caenorhabditis briggsae
Biotype  SO:0001217 Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG27247.1 CBG27247.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG27247 CBG27247   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

6 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day3_vs_Day1_upregulated
  Transcripts that showed significantly increased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day6_vs_Day1_upregulated
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day1_upregulated
  C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo. Benjamin and Hochberg corrected p-value < 0.05. WBPaper00051425:CB_L4_vs_embryo_upregulated
Heat shock: 34C 30min. Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min. DESeq2 v 1.18.1, fold change > 2, FDR < 0.01. WBPaper00058955:heatshock_upregulated_CBG
  C.briggsae proteins that showed significantly increased at L1 larva stage than in emrbyo. Benjamin and Hochberg corrected p-value < 0.05. WBPaper00051425:CB_L1_vs_embryo_upregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG27247, GTATCGGAGAAGGCTGAAGAGAAGAAGGATCAGGTCAAGGAGATGGCTGCTCAGGTTATC, WBGene00088661   Expr1061749 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region