WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00028314 Gene Name  Cbr-dnc-1
Sequence Name  ? CBG05960 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Dynein associated protein; CAP Gly-rich domain; CAP Gly-rich domain superfamily; and CAP-Gly domain. Is an ortholog of C. elegans dnc-1. In C. elegans, dnc-1 is involved in several processes, including establishment of mitotic spindle orientation; regulation of dendrite morphogenesis; and single fertilization. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG05960a.1 CBG05960a.1   [unknown]
Transcript:CBG05960b.1 CBG05960b.1   [unknown]
Transcript:CBG05960c.1 CBG05960c.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG05960a CBG05960a   [unknown]
CDS:CBG05960b CBG05960b   [unknown]
CDS:CBG05960c CBG05960c   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-dnc-1, GTATCCATTTGATATTGCCACTTCTATTCGATCAGCTCCACCGGTTCCAGAATCCAAAAA, WBGene00028314   Expr1066850 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region