WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00062191 Gene Name  Cre-athp-2
Sequence Name  ? CRE25005 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: WSTF, HB1, Itc1p, MBD9 motif 1; WSTF/Acf1/Cbp146; Bromodomain; WHIM1 domain; Bromodomain-like superfamily; Zinc finger, RING/FYVE/PHD-type; WHIM2 domain; Transport and Golgi organisation protein 2; ATP-utilising chromatin assembly and remodelling N-terminal; Zinc finger, FYVE/PHD-type; Williams-Beuren syndrome DDT (WSD), D-TOX E motif; DDT domain; Zinc finger, PHD-type; and Transport and Golgi organisation 2. Is an ortholog of C. elegans athp-2. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE25005.1 CRE25005.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE25005 CRE25005   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE25005, GTCTTCAAGGCAAATGTAAGAGTTGTCGTCGAAAAGCGGTGGCTCACGAGCTCATCTTGT, WBGene00062191   Expr1117604 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region