WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00036435 Gene Name  CBG16522
Sequence Name  ? CBG16522 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Polyketide cyclase / dehydrase and lipid transport; Coenzyme Q-binding protein COQ10, START domain; and START-like domain superfamily. Is an ortholog of C. elegans R144.13. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG16522c CBG16522c   [unknown]
Transcript:CBG16522a.2 CBG16522a.2   [unknown]
Transcript:CBG16522a.1 CBG16522a.1   [unknown]
Transcript:CBG16522b.1 CBG16522b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG16522b CBG16522b   [unknown]
CDS:CBG16522a CBG16522a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG16523, AACATAACAGTCAATGCATGCTCCAAGTGGATTCTGTGATTGCACCGAACGCACCGAAAG, WBGene00036436   Expr1054099 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG16522, CTGAGAAATTGTACGGAGCCCCTGAATTTCCACACACACCTCCACAAGTATTACAATATA, WBGene00036435   Expr1067845 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region