WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00135892 Gene Name  CJA16687
Sequence Name  ? CJA16687 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: FAM91 N-terminus; FAM91, C-terminal domain; FAM91 C-terminus; FAM91; and FAM91, N-terminal domain. Is an ortholog of C. elegans F33H2.2. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA16687.1 CJA16687.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA16687 CJA16687   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA28787, ACAAGATTTTTGTGGCCATTGATGATCAAACTAGTGTGTTGGAAGTGAGTAAGGGAGCTC, WBGene00184361   Expr1070317 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA16687, GTTCCTTTATTCAGCTCGTGGCTGAATTCTACAATTTGCAAACGGATTATTTCGCACGCA, WBGene00135892   Expr1091052 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region