WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00031908 Gene Name  Cbr-fln-1
Sequence Name  ? CBG10542 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Filamin/ABP280 repeat-like; CH domain superfamily; Immunoglobulin-like fold; Immunoglobulin E-set; Calponin homology domain; Calponin homology (CH) domain; and Filamin/ABP280 repeat. Is an ortholog of C. elegans fln-1. In C. elegans, fln-1 is involved in several processes, including axon development; semaphorin-plexin signaling pathway; and uterus morphogenesis. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG10542a.1 CBG10542a.1   [unknown]
Transcript:CBG10542b.1 CBG10542b.1   [unknown]
Transcript:CBG10542c.1 CBG10542c.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG10542c CBG10542c   [unknown]
CDS:CBG10542b CBG10542b   [unknown]
CDS:CBG10542a CBG10542a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo. Benjamin and Hochberg corrected p-value < 0.05. WBPaper00051425:CB_L4_vs_embryo_upregulated
  C.briggsae proteins that showed significantly increased at L1 larva stage than in emrbyo. Benjamin and Hochberg corrected p-value < 0.05. WBPaper00051425:CB_L1_vs_embryo_upregulated

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG10541, CATCGAAAGCCACGCTGGATGCGTATGAGCTGGAGAAGGGATACAAAGTGAGATACACTC, WBGene00031907   Expr1061712 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG10542, AAGGAGCAAAACTGAAAGTCCCTATTCGTCGATTTCTAGTGGATCATCGAGTACACCCAA, WBGene00031908   Expr1060931 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region