WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00214379 Gene Name  CJA38532
Sequence Name  ? CJA38532 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Leucine-rich repeat and Leucine-rich repeat domain superfamily. Is an ortholog of C. elegans mog-2. In C. elegans, mog-2 is involved in feminization of hermaphroditic germ-line; germline cell cycle switching, mitotic to meiotic cell cycle; and mRNA 3'-splice site recognition. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA38532a.1 CJA38532a.1   [unknown]
Transcript:CJA38532b.1 CJA38532b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA38532b CJA38532b   [unknown]
CDS:CJA38532a CJA38532a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA10279, GAAAATTGGACAATTTTCCGACGTTCACACGGCTCACCACTCTGTATCTGCACAATAATC, WBGene00129483   Expr1077361 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region