WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00042041 Gene Name  CBG23773
Sequence Name  ? CBG23773 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domain: Zinc finger C2H2-type. Is an ortholog of C. elegans lin-36. In C. elegans, lin-36 is involved in embryonic digestive tract morphogenesis. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG23773d.1 CBG23773d.1   [unknown]
Transcript:CBG23773c.1 CBG23773c.1   [unknown]
Transcript:CBG23773b.1 CBG23773b.1   [unknown]
Transcript:CBG23773a.1 CBG23773a.1   [unknown]
 

Other

4 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG23773a CBG23773a   [unknown]
CDS:CBG23773d CBG23773d   [unknown]
CDS:CBG23773c CBG23773c   [unknown]
CDS:CBG23773b CBG23773b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG23773, CAATGAGATCGTACTAACACCATCGCCAACGAAGAAGGCGTACACTCAGAATCCGGAAGA, WBGene00042041   Expr1054603 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region