WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00042510 Gene Name  CBG24384
Sequence Name  ? CBG24384 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domain: CUB-like domain. Is an ortholog of C. elegans K10D11.5. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG24384.1 CBG24384.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG24384 CBG24384   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

3 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day3_vs_Day1_upregulated
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day1_upregulated
Virus infection: Santeuil infected at L3 larva stage for 12 hours. Transcripts that showed signicantly increased expression after Santeuil virus infection to C. briggsae strain JU1264. edgeR, FDR < 0.05. WBPaper00051137:Santeuil-virus_upregulated_JU1264

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG24384, TTCAACACGGCATATCAAGCGTTGGGAGATGGTTTTAGTGCCACATTTAAAACATATGGA, WBGene00042510   Expr1068566 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region