WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00128029 Gene Name  CJA08825
Sequence Name  ? CJA08825 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: SHR-binding domain of vacuolar-sorting associated protein 13; Vacuolar protein sorting-associated protein 13; Vacuolar-sorting-associated 13 protein C-terminal; Vacuolar protein sorting-associated protein 13, C-terminal; Ricin B-like lectins; and Vacuolar protein sorting-associated protein 13, SHR-binding domain. Is an ortholog of C. elegans C25H3.11. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA08825b.1 CJA08825b.1   [unknown]
Transcript:CJA08825a.1 CJA08825a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA08825a CJA08825a   [unknown]
CDS:CJA08825b CJA08825b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA11382, GCGCCAAACAGCTGTACGATCACAATAAACGCACGCTGAATGACGTGGCGTGGACGAAAT, WBGene00130586   Expr1087555 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA08825, AACCGATGATCACTGCGGCGAGAAAGATTGGTAAGAAAGAGATGGACCTATTCAGCACAG, WBGene00128029   Expr1088285 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region